View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0517_high_1 (Length: 519)
Name: NF0517_high_1
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0517_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 427; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 427; E-Value: 0
Query Start/End: Original strand, 77 - 507
Target Start/End: Complemental strand, 37637888 - 37637458
Alignment:
| Q |
77 |
gagatgaaatatgtttaacatagttttcttttttgatggagaacaggaggaaggagagttgagtcccttcagcttctcaattgctgttagtgcttgtgcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637888 |
gagatgaaatatgtttaacatagttttcttttttgatggagaacaggaggaaggagagttgagtcccttcagcttctcaattgctgttagtgcttgtgcc |
37637789 |
T |
|
| Q |
177 |
tcaattgggtcaagtaacttgggtaagcaggtacatgctgcagtaattaatcatggatttgagtccaatcttcctgtgatgaacgccatactggacatgt |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637788 |
tcaattgggtcaagtaacttgggtaagcaggtacatgctgcagtaattaatcatggatttgagtccaatcttcctgtgatgaacgccatactggacatgt |
37637689 |
T |
|
| Q |
277 |
attgcaggtgtcgttgcgcatctgaggcaaaacaattattcggtgaaatgactcagaaagatacgattacatggaatactttgatagctggatttgaacc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
37637688 |
attgcaggtgtcgttgcgcatctgaggcaaaacaattattcggtgaaatgactcagaaagatacgattacatggaatactttgatagctggatttgaaac |
37637589 |
T |
|
| Q |
377 |
actggattcttatgagtctctctgcatattttcacaaatggtgtcagaaggttttagtccgaattgcttcacatttactagtgttatagctgcatgtgca |
476 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37637588 |
actggattcttatgagtctctctgcatattttcacaaatggtgtcagaaggttttagtccgaattgcttcacatttactagtgttatagctgcatgtgca |
37637489 |
T |
|
| Q |
477 |
aacttagcaattctgtattgtgggcaacagc |
507 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37637488 |
aacttagcaattctgtattgtgggcaacagc |
37637458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 189 times since January 2019
Visitors: 3648