View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0517_high_15 (Length: 251)
Name: NF0517_high_15
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0517_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 36946177 - 36946326
Alignment:
| Q |
1 |
tttcgcaacatctcttgcaaccgaggcagaaggagtaccatttagatttactaatgatgtagacattgatacagaagggaacgtttacttcaccgatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946177 |
tttcgcaacatctcttgcaaccgaagcagaaggagtaccatttagatttactaatgatgtagacattgatacagaagggaacgtttacttcaccgatagc |
36946276 |
T |
|
| Q |
101 |
agcactaaatatcagagaaggttgttagtaatctctttacttgttaacac |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36946277 |
agcactaaatatcagagaaggttgttagtaatctctttacttgttaacac |
36946326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 190 - 222
Target Start/End: Original strand, 36946321 - 36946353
Alignment:
| Q |
190 |
taacacaaaagtttggctggttttattggtgct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
36946321 |
taacacaaaagtttggctggttttattggtgct |
36946353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1124 times since January 2019
Visitors: 3663