View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0517_high_16 (Length: 250)
Name: NF0517_high_16
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0517_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 7240350 - 7240234
Alignment:
| Q |
107 |
cgtgctaatcggtcctctcagttttgctcaaaagttcattgatttatcggatcgtaactcccgatcgacttattatttgttgtgttatgcatgctctttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7240350 |
cgtgctaatcggtcctctcagttttgctcaaaagtttattgattcatcggatcataacccccgatcgacttattatttgttgtgttatgcatgctctttt |
7240251 |
T |
 |
| Q |
207 |
catcatgagtattattt |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7240250 |
catcatgagtattattt |
7240234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 180
Target Start/End: Complemental strand, 7240197 - 7240151
Alignment:
| Q |
134 |
tcaaaagttcattgatttatcggatcgtaactcccgatcgacttatt |
180 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
7240197 |
tcaagagttcattaatttatcgaatcgtaactcgcgatcgacttatt |
7240151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 179
Target Start/End: Complemental strand, 7240453 - 7240401
Alignment:
| Q |
127 |
gttttgctcaaaagttcattgatttatcggatcgtaactcccgatcgacttat |
179 |
Q |
| |
|
|||||| ||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
7240453 |
gttttgatcaaaagttcattgatttatcatatggtaactctagatcgacttat |
7240401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 180
Target Start/End: Complemental strand, 10540346 - 10540294
Alignment:
| Q |
128 |
ttttgctcaaaagttcattgatttatcggatcgtaactcccgatcgacttatt |
180 |
Q |
| |
|
||||||||||||| | | ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10540346 |
ttttgctcaaaagcccctcgatttatcggatcgtaacttccgatcggcttatt |
10540294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University