View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0517_high_16 (Length: 250)

Name: NF0517_high_16
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0517_high_16
NF0517_high_16
[»] chr3 (3 HSPs)
chr3 (107-223)||(7240234-7240350)
chr3 (134-180)||(7240151-7240197)
chr3 (127-179)||(7240401-7240453)
[»] chr7 (1 HSPs)
chr7 (128-180)||(10540294-10540346)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 7240350 - 7240234
Alignment:
107 cgtgctaatcggtcctctcagttttgctcaaaagttcattgatttatcggatcgtaactcccgatcgacttattatttgttgtgttatgcatgctctttt 206  Q
    |||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||| |||||||||||||||||||||||||||||||||||||||||    
7240350 cgtgctaatcggtcctctcagttttgctcaaaagtttattgattcatcggatcataacccccgatcgacttattatttgttgtgttatgcatgctctttt 7240251  T
207 catcatgagtattattt 223  Q
    |||||||||||||||||    
7240250 catcatgagtattattt 7240234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 134 - 180
Target Start/End: Complemental strand, 7240197 - 7240151
Alignment:
134 tcaaaagttcattgatttatcggatcgtaactcccgatcgacttatt 180  Q
    |||| |||||||| |||||||| |||||||||| |||||||||||||    
7240197 tcaagagttcattaatttatcgaatcgtaactcgcgatcgacttatt 7240151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 179
Target Start/End: Complemental strand, 7240453 - 7240401
Alignment:
127 gttttgctcaaaagttcattgatttatcggatcgtaactcccgatcgacttat 179  Q
    |||||| |||||||||||||||||||||  || |||||||  |||||||||||    
7240453 gttttgatcaaaagttcattgatttatcatatggtaactctagatcgacttat 7240401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 180
Target Start/End: Complemental strand, 10540346 - 10540294
Alignment:
128 ttttgctcaaaagttcattgatttatcggatcgtaactcccgatcgacttatt 180  Q
    |||||||||||||  | | ||||||||||||||||||| ||||||| ||||||    
10540346 ttttgctcaaaagcccctcgatttatcggatcgtaacttccgatcggcttatt 10540294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1566 times since January 2019
Visitors: 3672