View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0517_high_17 (Length: 249)
Name: NF0517_high_17
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0517_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 3308397 - 3308580
Alignment:
| Q |
1 |
tgttgttgttctccttgtgcaaactctatgagagccgcgccggtgttcttgagtgaggcggcgtaggaggaatgcgcagccgcgaagttgttacgggcgg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308397 |
tgttgttgttctccttgtgcaaaatctatgagagccgcgccggtgttcttgagtgaggctgcgtaggaggaatgcgcagccgcgaagttgttacgggcgg |
3308496 |
T |
|
| Q |
101 |
caaccgcctgtttcatgaagtaatgacggtctttacaacttgttatggcttcttcattctccgtttttgattggaaacaaccca |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3308497 |
caaccgcctgtttcatgaagtaatgacggtctttacaacttgttatggcttcttcattctccatttttgattggaaacaaccca |
3308580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 991 times since January 2019
Visitors: 3662