View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0517_low_21 (Length: 228)
Name: NF0517_low_21
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0517_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 37430494 - 37430585
Alignment:
| Q |
8 |
aggattttggatttgattattttagcctatatctatagaggttatgaagaggtttgaaagatgcagaagcatgacctacaaagcattgattg |
99 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37430494 |
aggattttttatttgattattttagcctctatctatagatgttatgaagaggtttgaaagatgcagaagcatgacctactaagcattgattg |
37430585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1369 times since January 2019
Visitors: 3669