View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0517_low_23 (Length: 227)
Name: NF0517_low_23
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0517_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 37430511 - 37430426
Alignment:
| Q |
1 |
aatcaaatccaaaatcctaaacaagagagtataatttcctctaaatggggtccttttgttttctatttccttatcttgcctttcac |
86 |
Q |
| |
|
|||||||| |||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37430511 |
aatcaaataaaaaatcctcaagaagagagtatagtttcctctaaatggggtccttttgttttctatttccttatcttgcctttcac |
37430426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 39 - 86
Target Start/End: Complemental strand, 37698509 - 37698462
Alignment:
| Q |
39 |
ctctaaatggggtccttttgttttctatttccttatcttgcctttcac |
86 |
Q |
| |
|
||||||||||||||||||| | ||||||| |||||| ||||||||||| |
|
|
| T |
37698509 |
ctctaaatggggtccttttttattctattgccttattttgcctttcac |
37698462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 207 times since January 2019
Visitors: 3648