View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0517_low_9 (Length: 349)
Name: NF0517_low_9
Description: NF0517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0517_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 32011985 - 32012216
Alignment:
Q |
10 |
attattctattaagatggtgaaagctttaattacaaggctattcatatgaagtgggtaatccatgtttacccatatctaagagagattttggaatgggtt |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32011985 |
attattctattaagatggtgaaagctttaattacaaggctattcatatgaagtgggtaatccatgtttacccatatctaagagagattttggaatgggtt |
32012084 |
T |
 |
Q |
110 |
aaaacaataataaatgcactaaagtttggtttaacaaaataattgagattttcaaactaggacaatcatcatctttagtatgcaatggcatagacaaact |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32012085 |
aaaacaataataaatgcactaaagtttggtttaacaaaataattgagattttcaaactaggacaatcatcatctttagtatgcaatggcatagacaaact |
32012184 |
T |
 |
Q |
210 |
taaatggcttccaacaagtaaatgtgccaatg |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
32012185 |
taaatggcttccaacaagtaaatgtgccaatg |
32012216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 380 times since January 2019
Visitors: 3650