View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0518_low_11 (Length: 259)
Name: NF0518_low_11
Description: NF0518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0518_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 29 - 247
Target Start/End: Original strand, 33453644 - 33453862
Alignment:
| Q |
29 |
actattagtcaggtgataaattcattaaagaaacttttaattcagttttcatatagaaaaaagtttggtagaattggtcacatgttattattccttaact |
128 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33453644 |
actattagtcaggtaataaattcattaaagaaacttttaattcagttttcatatagaaaaaagtttggtagaattggtcacatgttattattccttaact |
33453743 |
T |
|
| Q |
129 |
gcacaatatcaattattagaaattatattgagcaatagtgtcagtcaatatttattgttatattcatcaagttttcatactttctgccacttttgcatct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33453744 |
gcacaatatcaattattagaaattatattgagcaatagtatcagtcaatatttattgttatattcatcaagttttcatactttctgccacttttgcatct |
33453843 |
T |
|
| Q |
229 |
cttttacaaaagcctccta |
247 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33453844 |
cttttacaaaagcctccta |
33453862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 233 times since January 2019
Visitors: 3675