View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0518_low_13 (Length: 249)
Name: NF0518_low_13
Description: NF0518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0518_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 6 - 249
Target Start/End: Original strand, 33436217 - 33436475
Alignment:
| Q |
6 |
ccctagctgttgcttttatgattggttatgtaatctttatgttgtcttctttgtaaagacttgatgtacatgggttagggtaatccttgtactctttgct |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33436217 |
ccctagctattgcttttatgattggttatgtaatttttatgttgtcttctttgtaaagacttgatgtacatgggttagggtaatccttgtactctttgct |
33436316 |
T |
 |
| Q |
106 |
attaatttttgcttatctataaaaaagtgtaatataaaaagatgactgtcaatccgtc---------------attttatcgaagaataatgccacttct |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33436317 |
attaatttttgcttatctataaaaaagtgtaatataaaaagatgactgtcaatccgtctttctaaaatgcattattttatcgaagaataatgccacttct |
33436416 |
T |
 |
| Q |
191 |
cacgaaaaacttcttggcgaaaacgtcacaactgctatataagttttaacgcttgtaac |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33436417 |
cacgaaaaacttcttggcgaaaacgtcacaactgcaatataagttttaacgcttgtaac |
33436475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University