View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0518_low_14 (Length: 228)
Name: NF0518_low_14
Description: NF0518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0518_low_14 |
 |  |
|
[»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 2 - 228
Target Start/End: Complemental strand, 718623 - 718397
Alignment:
Q |
2 |
catcactcttctcagtcagccgaccatagagcgcatattccggcgctaggtatccgtgagttccggccactctagtagtgagatgagactgaccctccct |
101 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
718623 |
catcactcttctcagtcagctgaccatagagcgcatattccggcgctaggtatccgtgagttccggccactctagtagtgagatgagactgaccctccct |
718524 |
T |
 |
Q |
102 |
actttgtttcgcaagaccaaaatcagcaactcttgccctcatatcttcatcaagtagtatattggtagctttgatatccctatgataaattgcaggctta |
201 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
718523 |
actttgtttcgcaagaccaaaatcagcaactcttgccctcatatcttcatcaagtagtatattggtagctttgatatccctatgataaattgcaggctta |
718424 |
T |
 |
Q |
202 |
actccatagggtaaataagccaaccct |
228 |
Q |
|
|
||||||||| ||||||||||||||||| |
|
|
T |
718423 |
actccatagtgtaaataagccaaccct |
718397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 191
Target Start/End: Complemental strand, 11845356 - 11845312
Alignment:
Q |
147 |
ttcatcaagtagtatattggtagctttgatatccctatgataaat |
191 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
T |
11845356 |
ttcatcaagtagtatatttgtagatttgatatctctatgataaat |
11845312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 191
Target Start/End: Complemental strand, 11850085 - 11850041
Alignment:
Q |
147 |
ttcatcaagtagtatattggtagctttgatatccctatgataaat |
191 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
T |
11850085 |
ttcatcaagtagtatatttgtagatttgatatctctatgataaat |
11850041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 106 - 225
Target Start/End: Original strand, 36870868 - 36870987
Alignment:
Q |
106 |
tgtttcgcaagaccaaaatcagcaactcttgccctcatatcttcatcaagtagtatattggtagctttgatatccctatgataaattgcaggcttaactc |
205 |
Q |
|
|
|||||||| || || ||||| ||||| ||||| |||||| || ||||||||||||||||||||||||||||||| || ||||||| | ||||||||||| |
|
|
T |
36870868 |
tgtttcgccagcccgaaatctgcaacccttgctctcatacctgcatcaagtagtatattggtagctttgatatctctgtgataaacaggaggcttaactc |
36870967 |
T |
 |
Q |
206 |
catagggtaaataagccaac |
225 |
Q |
|
|
|| || | |||||| ||||| |
|
|
T |
36870968 |
caaagtgcaaataaaccaac |
36870987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 121 - 227
Target Start/End: Original strand, 36877470 - 36877576
Alignment:
Q |
121 |
aaatcagcaactcttgccctcatatcttcatcaagtagtatattggtagctttgatatccctatgataaattgcaggcttaactccatagggtaaataag |
220 |
Q |
|
|
||||| ||||| ||||| ||||||||| || |||||||||||||||| ||||||||||| || |||||||| ||||| ||||||||| || | |||||| |
|
|
T |
36877470 |
aaatctgcaacccttgctctcatatctgcaccaagtagtatattggtggctttgatatctctgtgataaatagcaggtttaactccaaagtgcaaataaa |
36877569 |
T |
 |
Q |
221 |
ccaaccc |
227 |
Q |
|
|
||||||| |
|
|
T |
36877570 |
ccaaccc |
36877576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 78
Target Start/End: Original strand, 36870761 - 36870837
Alignment:
Q |
2 |
catcactcttctcagtcagccgaccatagagcgcatattccggcgctaggtatccgtgagttccggccactctagta |
78 |
Q |
|
|
||||||||||||| || | | ||||||| || |||||||| || ||||| ||||| |||||||||| ||||||||| |
|
|
T |
36870761 |
catcactcttctcggttaactgaccataaagtgcatattctggagctagatatccacgagttccggctactctagta |
36870837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 191
Target Start/End: Complemental strand, 40598092 - 40598048
Alignment:
Q |
147 |
ttcatcaagtagtatattggtagctttgatatccctatgataaat |
191 |
Q |
|
|
|||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
T |
40598092 |
ttcatcaagtagtatatttgtagatttgatatctctatgataaat |
40598048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 191
Target Start/End: Complemental strand, 40598152 - 40598108
Alignment:
Q |
147 |
ttcatcaagtagtatattggtagctttgatatccctatgataaat |
191 |
Q |
|
|
|||||| ||||||||||| |||| ||||||||| ||||||||||| |
|
|
T |
40598152 |
ttcatctagtagtatatttgtagatttgatatctctatgataaat |
40598108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University