View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0518_low_4 (Length: 316)
Name: NF0518_low_4
Description: NF0518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0518_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 9 - 287
Target Start/End: Complemental strand, 336767 - 336489
Alignment:
Q |
9 |
agcagagaagccttgtgaataatctagcatactctctgtcgttgaagttgtttgttggttgctcatagtaacaacattgttgttgtcaaagagaggagag |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
336767 |
agcagagaagccttgtgaataatctagcatactctctgtcgttgaagttgtttgttggttgctcatagtaacaacattgttgttgtcaaagagaggagag |
336668 |
T |
 |
Q |
109 |
ctagcagtgtcatcaaggtgctgctgaatattattattttcttgaactttctgtctctttttacttctcttggcaacaagttttgttggcttagatgcag |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
336667 |
ctagcagtgtcatcaaggtgctgctgaatattattattttcttgaactttctgtctctttttacttctcttggcaacaagttttgttggcttagatgcag |
336568 |
T |
 |
Q |
209 |
aacagtcttgtgcattgaagtaagagtcatggtgtggaggaccagaagaagcatcagaaaccatggacaagtcctcttc |
287 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
336567 |
aacagtcttgtgcattgaagtaagagtcatggtgtggaggaccagaagaagcatcagaaaccatggacaagtcctcttc |
336489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 241 - 278
Target Start/End: Original strand, 48011835 - 48011872
Alignment:
Q |
241 |
tgtggaggaccagaagaagcatcagaaaccatggacaa |
278 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
T |
48011835 |
tgtggaggaccagaagaagcatcagaaaccatagacaa |
48011872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 241 - 288
Target Start/End: Complemental strand, 47592082 - 47592035
Alignment:
Q |
241 |
tgtggaggaccagaagaagcatcagaaaccatggacaagtcctcttct |
288 |
Q |
|
|
|||||||| |||||||||||||||||||||||||| || || |||||| |
|
|
T |
47592082 |
tgtggaggtccagaagaagcatcagaaaccatggataaatcttcttct |
47592035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1211 times since January 2019
Visitors: 3665