View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_high_14 (Length: 312)
Name: NF0519_high_14
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0519_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 41 - 307
Target Start/End: Complemental strand, 9699194 - 9698915
Alignment:
Q |
41 |
gttaatgtgcttgatgcgccgtggttatcaatctcaaccgtccgatgcaa-------------tctaagttgtctaatgatctcatggtcaaaattattt |
127 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
9699194 |
gttaatgtgcttgatgcgccgtggttatcaatctcaaccatccgatgcaaatcaaagatgcaatctaagttgtctaatgatctcatggtcaaaattattt |
9699095 |
T |
 |
Q |
128 |
actgtgtgcaactacataatgtagttacagtagtgaatctgaattcgctagacgcgagtggttaatgtgcatcatctaaaaggatggttagtttctgatg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
9699094 |
actgtgtgcaactacataatgtagttacagtagtgaatctgaattcgctagacgcgagtggttaatgtgcatcatctaaaagaatggttagtttctgatg |
9698995 |
T |
 |
Q |
228 |
atgaaacaattcgcagtcaaactttagttaccttctgatcgaaaataaattagtcttggaaccattttccctatgatact |
307 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
T |
9698994 |
atgaaacaattcgcagtcaaactttagttaccttctgatcgaaaataaattagtcttaaaaccattttctctatgatact |
9698915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1647 times since January 2019
Visitors: 3672