View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_high_17 (Length: 261)
Name: NF0519_high_17
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0519_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 41 - 230
Target Start/End: Complemental strand, 9699194 - 9698992
Alignment:
| Q |
41 |
gttaatgtgcttgatgcgccgtggttatcaatctcaaccgtccgatgcaa-------------tctaagttgtctaatgatctcatggtcaaaattattt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699194 |
gttaatgtgcttgatgcgccgtggttatcaatctcaaccatccgatgcaaatcaaagatgcaatctaagttgtctaatgatctcatggtcaaaattattt |
9699095 |
T |
|
| Q |
128 |
actgtgtgcaactacataatgtagttacagtagtgaatctgaattcgctagacgcgagtggttaatgtgcatcatctaaaaggatggttagtttctgatg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9699094 |
actgtgtgcaactacataatgtagttacagtagtgaatctgaattcgctagacgcgagtggttaatgtgcatcatctaaaagaatggttagtttctgatg |
9698995 |
T |
|
| Q |
228 |
atg |
230 |
Q |
| |
|
||| |
|
|
| T |
9698994 |
atg |
9698992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1312 times since January 2019
Visitors: 3667