View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_high_23 (Length: 202)
Name: NF0519_high_23
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0519_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 79 - 186
Target Start/End: Complemental strand, 32121420 - 32121313
Alignment:
| Q |
79 |
tgaaagtttagttgggagcgagcaattcctgatgggggaagagcattttccaataaagagtttacttgagaactttcaataaggtgcataagctttagaa |
178 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32121420 |
tgaaagtttggttgggagcgagcaattcgtgacgggggaagagcattttccagtaaagagtttacttgaaaactttcaataaggtgcataagctttagaa |
32121321 |
T |
 |
| Q |
179 |
cttttagt |
186 |
Q |
| |
|
|||||||| |
|
|
| T |
32121320 |
cttttagt |
32121313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 32122586 - 32122523
Alignment:
| Q |
19 |
acattctaaagtactagtaaaattgtgttgtagtgtttcctttgaagttttcatacaaggtgaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32122586 |
acattctaaagtactagtaaaattgtgttgtagtgtttcctttgaagttttcatacaaggtgaa |
32122523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 80 - 127
Target Start/End: Complemental strand, 53214335 - 53214288
Alignment:
| Q |
80 |
gaaagtttagttgggagcgagcaattcctgatgggggaagagcatttt |
127 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | |||||||||| |
|
|
| T |
53214335 |
gaaagtttagttgggagcgagcaatttttgatgggaggagagcatttt |
53214288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 79 - 126
Target Start/End: Original strand, 28009235 - 28009282
Alignment:
| Q |
79 |
tgaaagtttagttgggagcgagcaattcctgatgggggaagagcattt |
126 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
28009235 |
tgaaagtttggttgggagcgagcaatttttgatgggagaagagcattt |
28009282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 79 - 126
Target Start/End: Original strand, 28066538 - 28066585
Alignment:
| Q |
79 |
tgaaagtttagttgggagcgagcaattcctgatgggggaagagcattt |
126 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
28066538 |
tgaaagtttggttgggagcgagcaatttttgatgggagaagagcattt |
28066585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University