View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_low_10 (Length: 369)
Name: NF0519_low_10
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0519_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 1e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 175 - 282
Target Start/End: Original strand, 32121313 - 32121420
Alignment:
Q |
175 |
actaaaagttctaaagcttatgcaccttattgaaagttttcaagtaaactctttattggaaaatgctcttcccccatcaggaattgctcgctcccaacta |
274 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||| | |
|
|
T |
32121313 |
actaaaagttctaaagcttatgcaccttattgaaagttttcaagtaaactctttactggaaaatgctcttcccccgtcacgaattgctcgctcccaacca |
32121412 |
T |
 |
Q |
275 |
aactttca |
282 |
Q |
|
|
|||||||| |
|
|
T |
32121413 |
aactttca |
32121420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 279 - 342
Target Start/End: Original strand, 32122523 - 32122586
Alignment:
Q |
279 |
ttcaccttgtatgaaaacttcaaaggaaacactacaacacaattttactagtactttagaatgt |
342 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32122523 |
ttcaccttgtatgaaaacttcaaaggaaacactacaacacaattttactagtactttagaatgt |
32122586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 234 - 281
Target Start/End: Original strand, 53214288 - 53214335
Alignment:
Q |
234 |
aaaatgctcttcccccatcaggaattgctcgctcccaactaaactttc |
281 |
Q |
|
|
|||||||||| | ||||||| |||||||||||||||||||||||||| |
|
|
T |
53214288 |
aaaatgctctcctcccatcaaaaattgctcgctcccaactaaactttc |
53214335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 282
Target Start/End: Complemental strand, 28009282 - 28009235
Alignment:
Q |
235 |
aaatgctcttcccccatcaggaattgctcgctcccaactaaactttca |
282 |
Q |
|
|
||||||||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
T |
28009282 |
aaatgctcttctcccatcaaaaattgctcgctcccaaccaaactttca |
28009235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 235 - 282
Target Start/End: Complemental strand, 28066585 - 28066538
Alignment:
Q |
235 |
aaatgctcttcccccatcaggaattgctcgctcccaactaaactttca |
282 |
Q |
|
|
||||||||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
T |
28066585 |
aaatgctcttctcccatcaaaaattgctcgctcccaaccaaactttca |
28066538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 755 times since January 2019
Visitors: 3656