View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_low_14 (Length: 332)
Name: NF0519_low_14
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0519_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 30 - 321
Target Start/End: Original strand, 35220801 - 35221097
Alignment:
| Q |
30 |
acttcctctatttttgggggttatgattgaaaatgactagctaaatattgatgtattcactgtactgtgccatttgcagaaggcacattcaggttcacta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35220801 |
acttcctctatttttgggggttatgattgaaaatgactagctaaatattgatgtattcactgtactgtgccatttgcagaaggcacattcaggttcacta |
35220900 |
T |
 |
| Q |
130 |
atattttgtaatgt-----tatgaaaagttatgatgcatgttatttattctaaatccgaagggaagattccaattgtttgttgcaacttgcatttcatac |
224 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35220901 |
atattttgtaatgttatgttatgaaaagttatgatgcatgttatttattctaaatccgaagggaagattccaattgtttgttgcaacttgcatttcatac |
35221000 |
T |
 |
| Q |
225 |
atatgcttaatgatcctatatttccctctcaagttgccacgtactgttcatttccataactatctctcaacttgcagggtggggttttgatgttcat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35221001 |
atatgcttaatgatcctatatttccctctcaagttgccacgtactgttcatctccataactatctctcaacttgcagggtggggttttgatgatcat |
35221097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University