View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_low_15 (Length: 320)
Name: NF0519_low_15
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0519_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 44 - 291
Target Start/End: Complemental strand, 44925503 - 44925278
Alignment:
Q |
44 |
gcagtaagcatattgtggaaggttgttgtaatatcatgcactagcaacgataaaataaagcatcacgtccctagcctagaaaatttatggacttaacaca |
143 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44925503 |
gcagtaagcatattgtggaaggttgttgtaacatcatgcactagcaacgataaaataaagcatcacgtccctagcctagaaaatttatggacttaacaca |
44925404 |
T |
 |
Q |
144 |
agaagatcatcttaaaagaaagnnnnnnntagaggcattctaagtaatgagaataattactaaaatgaaagaaaacaatttcgcttcaagtatggcctgc |
243 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
44925403 |
agaagatcatcttaaaagaaagaaaaaaatagaggcattctaagtaatg----------------------aaaacaatttcgcttcaagtatggcctgc |
44925326 |
T |
 |
Q |
244 |
atctgatggaccacattggctagtagaattcatatttgatgcagtaga |
291 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44925325 |
atctgatggaccacattggctagtagaattcatatttgatgcagtaga |
44925278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University