View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0519_low_15 (Length: 320)

Name: NF0519_low_15
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0519_low_15
NF0519_low_15
[»] chr1 (1 HSPs)
chr1 (44-291)||(44925278-44925503)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 44 - 291
Target Start/End: Complemental strand, 44925503 - 44925278
Alignment:
44 gcagtaagcatattgtggaaggttgttgtaatatcatgcactagcaacgataaaataaagcatcacgtccctagcctagaaaatttatggacttaacaca 143  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44925503 gcagtaagcatattgtggaaggttgttgtaacatcatgcactagcaacgataaaataaagcatcacgtccctagcctagaaaatttatggacttaacaca 44925404  T
144 agaagatcatcttaaaagaaagnnnnnnntagaggcattctaagtaatgagaataattactaaaatgaaagaaaacaatttcgcttcaagtatggcctgc 243  Q
    ||||||||||||||||||||||       ||||||||||||||||||||                      |||||||||||||||||||||||||||||    
44925403 agaagatcatcttaaaagaaagaaaaaaatagaggcattctaagtaatg----------------------aaaacaatttcgcttcaagtatggcctgc 44925326  T
244 atctgatggaccacattggctagtagaattcatatttgatgcagtaga 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
44925325 atctgatggaccacattggctagtagaattcatatttgatgcagtaga 44925278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 749 times since January 2019
Visitors: 3656