View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_low_23 (Length: 219)
Name: NF0519_low_23
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0519_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 30346146 - 30346034
Alignment:
Q |
1 |
aagtagaaaatttatctgcacatggtgcagtacaagtgctgatttcctctaatagtaatgcttactaactactaaagtcactgagcactagaagaatgta |
100 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
T |
30346146 |
aagtagaaaatttatctgcgcatggtgcagtacaagtgctgatttcctctaatagtaatgcttact--------aagtcactaagcactagaagaatgta |
30346055 |
T |
 |
Q |
101 |
cagaggaataatagaagtgct |
121 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
30346054 |
cagaggaataatagaagtgct |
30346034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University