View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0519_low_24 (Length: 218)
Name: NF0519_low_24
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0519_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 30346122 - 30346206
Alignment:
| Q |
1 |
ccatgtgcagataaattttctacttattagatcaacaagtcacgtcatatcacatttgatctaatgatattatagtaagatttat |
85 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30346122 |
ccatgcgcagataaattttctacttattagatcaacaagtcacgtcatatcacatttgatctaatgatattatagtaagacttat |
30346206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University