View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0519_low_24 (Length: 218)

Name: NF0519_low_24
Description: NF0519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0519_low_24
NF0519_low_24
[»] chr7 (1 HSPs)
chr7 (1-85)||(30346122-30346206)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 30346122 - 30346206
Alignment:
1 ccatgtgcagataaattttctacttattagatcaacaagtcacgtcatatcacatttgatctaatgatattatagtaagatttat 85  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
30346122 ccatgcgcagataaattttctacttattagatcaacaagtcacgtcatatcacatttgatctaatgatattatagtaagacttat 30346206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 343 times since January 2019
Visitors: 3649