View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0520_high_18 (Length: 245)
Name: NF0520_high_18
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0520_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 40 - 226
Target Start/End: Complemental strand, 17444251 - 17444063
Alignment:
| Q |
40 |
aaaattaacattcggtacacaaggtatttagggtttaaacccggcccctgcatatagcgcgtgtgtatgtgnnnnnnn--cttttaaattagtattagta |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
17444251 |
aaaattaacattcggtacacaaggtatttagggtttaaacccggcccctacatatcgcgcgtgtgtatgtgtttttttttctttttcattagtattagta |
17444152 |
T |
 |
| Q |
138 |
tgacaaacactacacttataattcctcccataatttcaacttgcagggtttcatgctcttttggaaattcaatagtcttcacaattgat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17444151 |
tgacaaacactacacttataattcctcccataatttcaacttgcagggttgcatgctcttttggaaattcaatagtcttcacaattgat |
17444063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University