View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0520_high_18 (Length: 245)

Name: NF0520_high_18
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0520_high_18
NF0520_high_18
[»] chr4 (1 HSPs)
chr4 (40-226)||(17444063-17444251)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 40 - 226
Target Start/End: Complemental strand, 17444251 - 17444063
Alignment:
40 aaaattaacattcggtacacaaggtatttagggtttaaacccggcccctgcatatagcgcgtgtgtatgtgnnnnnnn--cttttaaattagtattagta 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||         |||||  |||||||||||||    
17444251 aaaattaacattcggtacacaaggtatttagggtttaaacccggcccctacatatcgcgcgtgtgtatgtgtttttttttctttttcattagtattagta 17444152  T
138 tgacaaacactacacttataattcctcccataatttcaacttgcagggtttcatgctcttttggaaattcaatagtcttcacaattgat 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
17444151 tgacaaacactacacttataattcctcccataatttcaacttgcagggttgcatgctcttttggaaattcaatagtcttcacaattgat 17444063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University