View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0520_high_4 (Length: 424)

Name: NF0520_high_4
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0520_high_4
NF0520_high_4
[»] chr5 (1 HSPs)
chr5 (337-390)||(42010365-42010418)
[»] chr3 (1 HSPs)
chr3 (337-383)||(1245710-1245756)


Alignment Details
Target: chr5 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 337 - 390
Target Start/End: Complemental strand, 42010418 - 42010365
Alignment:
337 gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgatgatgatg 390  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
42010418 gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgatgatgatg 42010365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 337 - 383
Target Start/End: Complemental strand, 1245756 - 1245710
Alignment:
337 gcttttgaatcttgtaaagctgaggagataaacgtgatgaagacgat 383  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||    
1245756 gcttttgaatcttgtaaagccgaggagataaacgtgatgaagacgat 1245710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University