View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0520_high_9 (Length: 362)
Name: NF0520_high_9
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0520_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 43453675 - 43453414
Alignment:
Q |
1 |
tgttgatagtataaggcagtttactgggaaaaagtaattaaactttgattaaaataagtagctagaaaacgaactttgaagctcacaaaagaacaatggt |
100 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43453675 |
tgttgatagtataaggcagtttactggaaaaaagtaattaaactttgattaaaataagtagctagaaaacgaactttgaagctcacaaaagaacaatggt |
43453576 |
T |
 |
Q |
101 |
tagagattggtataatttggagaaggggattatttccaaacctggtttgaagaaaatggacagtccaaaatcaattgccataagagtggaatcttcatct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43453575 |
tagagattggtataatttggagaaggggattatttccaaacctggtttgaagaaaatggacagtccaaaatcaattgccataagagtggaatcttcatct |
43453476 |
T |
 |
Q |
201 |
ccatcaacaaaaaggaaattttcaggcttaagatcacgatgcataactccacatgagtgaca |
262 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
43453475 |
ccatcaacaaaaaggaaattttcaggcttaagatcacgatgcataactccacgtgagtgaca |
43453414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 95 - 262
Target Start/End: Complemental strand, 43463020 - 43462853
Alignment:
Q |
95 |
aatggttagagattggtataatttggagaaggggattatttccaaacctggtttgaagaaaatggacagtccaaaatcaattgccataagagtggaatct |
194 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| | |||| ||||||||||||||| ||||||| |||||| |
|
|
T |
43463020 |
aatggttagagattggtataaattggagaaggggattatttccatacctggtttgaagaaactagacaatccaaaatcaattgctttaagagttgaatct |
43462921 |
T |
 |
Q |
195 |
tcatctccatcaacaaaaaggaaattttcaggcttaagatcacgatgcataactccacatgagtgaca |
262 |
Q |
|
|
|||| ||||||||||||||| |||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
T |
43462920 |
tcatgtccatcaacaaaaagaaaattttcaggcttaagatcacaatgcataactccacgtgagtgaca |
43462853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 215 - 247
Target Start/End: Complemental strand, 8403628 - 8403596
Alignment:
Q |
215 |
gaaattttcaggcttaagatcacgatgcataac |
247 |
Q |
|
|
|||||| |||||||||||||||||||||||||| |
|
|
T |
8403628 |
gaaattctcaggcttaagatcacgatgcataac |
8403596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 228 times since January 2019
Visitors: 3648