View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0520_low_14 (Length: 314)
Name: NF0520_low_14
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0520_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 5414718 - 5414942
Alignment:
| Q |
1 |
aacactttaccatacctacaacaatttgcaacagcacaccaaaaatccttgtcaaaaacaaacaatctcgcgtggcttttcttatttttcattaaagtga |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5414718 |
aacactttaccatacctgcaacaatttgcaacagcacaccacaaatccttgtcaaaaacaaacaatctcgcgtggcttttcttatttttaattaaagtga |
5414817 |
T |
 |
| Q |
101 |
cactaacgaccattttactggcaaacacactttctatgaagctttatctcttgagcttcatagaaaggtagctatgcctatgaatgaaagtgagttaaac |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5414818 |
cactaacgaccattttactgacaaacacactttctatgaagctttgtctcttgagcttcatagaaaggtagctatgccaatgaatgaaagtgagttaaac |
5414917 |
T |
 |
| Q |
201 |
taaaatgaagtattgtatgatgatg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
5414918 |
taaaatgaagtattgtatgatgatg |
5414942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University