View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0520_low_18 (Length: 250)
Name: NF0520_low_18
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0520_low_18 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 51 - 250
Target Start/End: Original strand, 26806367 - 26806566
Alignment:
Q |
51 |
aaaaaatattaagttctaatataattgaatgttagtataaattttggagacggtccctgtattttataaattcacaaagttttccaataaatacttttaa |
150 |
Q |
|
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
T |
26806367 |
aaaaaataataagttctagtataattgaatgttagtataaattttggagatggtccctgtattttataaatttacaaagttttccaataaatacttctaa |
26806466 |
T |
 |
Q |
151 |
aaaattccaaattggtccttatatannnnnnncaaaattaacaaacctagattatcaaattttgtaaattagtccctattttgagaatgtagaattttat |
250 |
Q |
|
|
||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
26806467 |
aaaatcccaaattggtccttatatatttttttcaaaattaacaaacctagattatcaaattttgtaaattagtccctattttgagaatcgagaattttat |
26806566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 677 times since January 2019
Visitors: 3655