View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0520_low_20 (Length: 220)

Name: NF0520_low_20
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0520_low_20
NF0520_low_20
[»] chr1 (1 HSPs)
chr1 (65-215)||(1503256-1503405)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 65 - 215
Target Start/End: Complemental strand, 1503405 - 1503256
Alignment:
65 ccaaaatgggaggtatcagcctcgaagagattaaaaatgaaagcgtcgatcttgtacgtattctatattgttactttccccttatcttatcttttctttt 164  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1503405 ccaacatgggaggtatcagcctcgaagagattaaaaatgaaagcgtcgatcttgtacgtattctatattgttactttccccttatcttatcttttctttt 1503306  T
165 tcataccannnnnnnncccactctctcaccatttttcttcatgtaggtttc 215  Q
    ||||||||        ||||||||| |||||||||||||||||||||||||    
1503305 tcatacca-tttttttcccactctcccaccatttttcttcatgtaggtttc 1503256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University