View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0520_low_20 (Length: 220)
Name: NF0520_low_20
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0520_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 65 - 215
Target Start/End: Complemental strand, 1503405 - 1503256
Alignment:
| Q |
65 |
ccaaaatgggaggtatcagcctcgaagagattaaaaatgaaagcgtcgatcttgtacgtattctatattgttactttccccttatcttatcttttctttt |
164 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1503405 |
ccaacatgggaggtatcagcctcgaagagattaaaaatgaaagcgtcgatcttgtacgtattctatattgttactttccccttatcttatcttttctttt |
1503306 |
T |
 |
| Q |
165 |
tcataccannnnnnnncccactctctcaccatttttcttcatgtaggtttc |
215 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1503305 |
tcatacca-tttttttcccactctcccaccatttttcttcatgtaggtttc |
1503256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University