View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0520_low_3 (Length: 428)
Name: NF0520_low_3
Description: NF0520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0520_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 264
Target Start/End: Original strand, 37174025 - 37174278
Alignment:
| Q |
11 |
cacagacatttgaatggcctgaaatactttctttaccatcgaaaacttacaagatatatttttataaaatatctacagttaacttcaagttgaagtttat |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37174025 |
cacagacatttgaatggactgaaatactttctttaccatcgaaaacttacaagatatatttttaaaaaatatctaccgttaacttcaagttgaagtttat |
37174124 |
T |
|
| Q |
111 |
ggtacacattttaaaatacatatatcgtgtagacggtaaagtttatagtatattctccatggtgaattaaagtttgaatttcagttaagataaatattga |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
37174125 |
ggtacatattttaaaatacatatatcgtgtagacggtaaagtttatagtatattctccatggtgaatcaaagtttgaatttcagttaagataagtattga |
37174224 |
T |
|
| Q |
211 |
tatttagtgttcgacaatgtctcgaatataattatgtctgatggagtgaacttg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37174225 |
tatttagtgttcgacaatgtctcgaatataattatgtctgatggagtgaacttg |
37174278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 322 - 400
Target Start/End: Original strand, 37174336 - 37174414
Alignment:
| Q |
322 |
atcggaatactttgaaaaattaagattgcatatctattatctttacacaatcgaataacatgtccatattgttgaaaat |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37174336 |
atcggaatactttgaaaaattaagattgcatatcttttatctttacaccatcgaataacatgtccatattgttgaaaat |
37174414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1178 times since January 2019
Visitors: 3641