View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0524_high_7 (Length: 271)

Name: NF0524_high_7
Description: NF0524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0524_high_7
NF0524_high_7
[»] chr7 (1 HSPs)
chr7 (20-238)||(7656616-7656834)
[»] chr4 (1 HSPs)
chr4 (60-243)||(23340264-23340447)
[»] chr1 (1 HSPs)
chr1 (57-243)||(52102287-52102473)
[»] chr6 (1 HSPs)
chr6 (165-229)||(24833931-24833995)
[»] chr2 (1 HSPs)
chr2 (153-201)||(43585611-43585659)


Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 238
Target Start/End: Original strand, 7656616 - 7656834
Alignment:
20 gacatcatcatttgcattatcctcagatatatcagtatggaatgcacttctttttgaaattgtgatgacatttggattggtatacacagtttatgcaacc 119  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
7656616 gacatcagcatttgcattatcctcagatatatcagtatggaatgcacttctttttgaaattgtgatgacatttggattggtatacacagtttatgcaaca 7656715  T
120 gcagtagatccnnnnnnngggaatgtaggaattattgctccaattgcaattggtatcattgttggtgcaaatatcttagctggtggagcatttgatggtg 219  Q
    |||||||||||       |||||| ||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
7656716 gcagtagatccaaaaaaagggaatataggaattattgctccaattgcaattggtgttattgttggtgcaaatatcttagctggtggagcatttgatggtg 7656815  T
220 catccatgaatccagctgt 238  Q
    |||||||||||||||||||    
7656816 catccatgaatccagctgt 7656834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 60 - 243
Target Start/End: Original strand, 23340264 - 23340447
Alignment:
60 aatgcacttctttttgaaattgtgatgacatttggattggtatacacagtttatgcaaccgcagtagatccnnnnnnngggaatgtaggaattattgctc 159  Q
    ||||||||| | ||||| ||||||||||| ||||| ||||| |||||||| ||||| || |||||||| ||       || |   ||||||  |||||||    
23340264 aatgcacttgtgtttgagattgtgatgacttttggtttggtttacacagtgtatgctactgcagtagacccaaaaaatggtagcctaggaacaattgctc 23340363  T
160 caattgcaattggtatcattgttggtgcaaatatcttagctggtggagcatttgatggtgcatccatgaatccagctgtttctt 243  Q
    |||||||||||||| |||| ||||| || || |||||||| ||||| ||||||||||||||||||||||| ||||| |||||||    
23340364 caattgcaattggtttcatagttggagctaacatcttagcaggtggtgcatttgatggtgcatccatgaacccagcagtttctt 23340447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 57 - 243
Target Start/End: Complemental strand, 52102473 - 52102287
Alignment:
57 tggaatgcacttctttttgaaattgtgatgacatttggattggtatacacagtttatgcaaccgcagtagatccnnnnnnngggaatgtaggaattattg 156  Q
    ||||||||| |  ||||||| |||||||||||||||||||| ||||| |||||||||||||| ||| |||| ||       |||||||| ||  || | |    
52102473 tggaatgcattagtttttgagattgtgatgacatttggattagtatatacagtttatgcaacagcaatagacccaaagagagggaatgttggtgttgtag 52102374  T
157 ctccaattgcaattggtatcattgttggtgcaaatatcttagctggtggagcatttgatggtgcatccatgaatccagctgtttctt 243  Q
    | ||| | |||||||||   ||||| |||||||||||||| | |||||| |  |||||||||||||| ||||| |||||||| ||||    
52102373 caccattagcaattggttgtattgtgggtgcaaatatcttggttggtggtgtttttgatggtgcatcaatgaacccagctgtgtctt 52102287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 229
Target Start/End: Original strand, 24833931 - 24833995
Alignment:
165 gcaattggtatcattgttggtgcaaatatcttagctggtggagcatttgatggtgcatccatgaa 229  Q
    ||||||||  |||||||||||||||||||| | | ||||||  |||||||||| |||| ||||||    
24833931 gcaattggactcattgttggtgcaaatatccttgttggtggtccatttgatggagcatgcatgaa 24833995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 201
Target Start/End: Original strand, 43585611 - 43585659
Alignment:
153 attgctccaattgcaattggtatcattgttggtgcaaatatcttagctg 201  Q
    ||||| |||||||| |||||| | ||||||||||| |||||||||||||    
43585611 attgcaccaattgctattggtttgattgttggtgccaatatcttagctg 43585659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 58 times since January 2019
Visitors: 3646