View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0524_low_10 (Length: 281)

Name: NF0524_low_10
Description: NF0524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0524_low_10
NF0524_low_10
[»] chr1 (1 HSPs)
chr1 (125-236)||(44636435-44636546)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 44636546 - 44636435
Alignment:
125 atggataaaacagtttatcatatatcatggttttggttccttcaaaaaataaaagtatatcatggttttggttttcagtatatttttccacattttcatt 224  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44636546 atggataaaactgtttatcatatatcatggttttggttccttcaaaaaataaaagtatatcatggttttggttttcagtatatttttccacattttcatt 44636447  T
225 actttacctttg 236  Q
    ||||||||||||    
44636446 actttacctttg 44636435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1278 times since January 2019
Visitors: 3643