View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0524_low_10 (Length: 281)
Name: NF0524_low_10
Description: NF0524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0524_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 125 - 236
Target Start/End: Complemental strand, 44636546 - 44636435
Alignment:
Q |
125 |
atggataaaacagtttatcatatatcatggttttggttccttcaaaaaataaaagtatatcatggttttggttttcagtatatttttccacattttcatt |
224 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44636546 |
atggataaaactgtttatcatatatcatggttttggttccttcaaaaaataaaagtatatcatggttttggttttcagtatatttttccacattttcatt |
44636447 |
T |
 |
Q |
225 |
actttacctttg |
236 |
Q |
|
|
|||||||||||| |
|
|
T |
44636446 |
actttacctttg |
44636435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1278 times since January 2019
Visitors: 3643