View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0525_low_3 (Length: 246)
Name: NF0525_low_3
Description: NF0525
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0525_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 26155375 - 26155158
Alignment:
Q |
1 |
atcctttacaatgtggggatggtagttggatgattagtcattattggtggtgagtcacaattggtgcacatcctttattggtccacttgtatgtgccgtc |
100 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
T |
26155375 |
atcctttacaatgtggagatggtagttggatgattagtcattattggtggtgagtcacaattgatgcacaccctttattggtccacttgtatgtgccgtc |
26155276 |
T |
 |
Q |
101 |
caaacttgtctctcattcatctttgttttggtttgtttatttcactttcttctactaattgtcatcatgttcaaaatggacttattccaattttctttta |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
26155275 |
caaacttgtctctcattcatctttgttttggtttgtttatttcgctttcttctactaattgtcatcatgttcaaaatggacttatgccaattttctttta |
26155176 |
T |
 |
Q |
201 |
ttctatagcatatggttt |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
26155175 |
ttctatagcatatggttt |
26155158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 26168673 - 26168456
Alignment:
Q |
1 |
atcctttacaatgtggggatggtagttggatgattagtcattattggtggtgagtcacaattggtgcacatcctttattggtccacttgtatgtgccgtc |
100 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
T |
26168673 |
atcctttacaatgtggagatggtagttggatgattagtcattattggtggtgagtcacaattgatgcacaccctttattggtccacttgtatgtgccgtc |
26168574 |
T |
 |
Q |
101 |
caaacttgtctctcattcatctttgttttggtttgtttatttcactttcttctactaattgtcatcatgttcaaaatggacttattccaattttctttta |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
26168573 |
caaacttgtctctcattcatctttgttttggtttgtttatttcgctttcttctactaattgtcatcatgttcaaaatggacttatgccaattttctttta |
26168474 |
T |
 |
Q |
201 |
ttctatagcatatggttt |
218 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
26168473 |
ttctatagcatatggttt |
26168456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1314 times since January 2019
Visitors: 3643