View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_18 (Length: 452)
Name: NF0526_high_18
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 11 - 315
Target Start/End: Complemental strand, 16683885 - 16683581
Alignment:
Q |
11 |
cacagaaatttctccagaaactaggatgtattgttatatctgtttcctccggattcgaatgccttagtctcgttggccatggtggtgcatgcccctttga |
110 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16683885 |
cacagaaatttctccggaaactaggatgtattgttacatctgtttcctccggattcgaatgccttagtctcgttggccatggtggtgcatgcccctttga |
16683786 |
T |
 |
Q |
111 |
agttgttcttttggaccttcacttgcctgatttagatggatttgaagttaccgcaaggatccggaagtccaaaagccgtaactggcctatcgttgttgct |
210 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
16683785 |
agttgttattttggaccttcacttgcctgatttagatggatttgaagttactgcaaggatccggaagtccaaaagccgtaactggcctatcgctgttgct |
16683686 |
T |
 |
Q |
211 |
ttatcggcaagctcagaagaagaattaagggaaaaatgtatgcatattgggtttaatggagttatccgaaagccgattctgttgcaaggattcacggaag |
310 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
16683685 |
ttatcggcaagctcagaagaagaattaagggaaaaatgtatgcatattgggtttaatggagttatccgaaagccgattctgttgcaaggattcgcggaag |
16683586 |
T |
 |
Q |
311 |
aactc |
315 |
Q |
|
|
||||| |
|
|
T |
16683585 |
aactc |
16683581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University