View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_21 (Length: 431)
Name: NF0526_high_21
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 29 - 271
Target Start/End: Complemental strand, 47561488 - 47561248
Alignment:
Q |
29 |
aactttcatcatgtatgatgtatgatttgttaacttaaccttatatgtacggaacctattgataagtatatttgaatttcattctctatgacttggtaag |
128 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47561488 |
aactttcatcatgtatgatgtatgatttattaacttaaccgtatatgtacggaacctattgataagtatatttgaatttcattctctatgacttggtaag |
47561389 |
T |
 |
Q |
129 |
atgatgttgctcaaacacatatacattcaatagtttgagaattagggatgtcaatggggagagacactgatttctcgtctcttcccgttcctacacggtg |
228 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||| ||||||||||||||||||| |||||| |
|
|
T |
47561388 |
atgatgttgctcaaacacatatacattcaatagtttgagaattagggatgtcaatagggagagatagtgattgctcgtctcttcccgttcct--acggtg |
47561291 |
T |
 |
Q |
229 |
gcggagcattgtatgggctgagatggaccgcggtatacccatc |
271 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
47561290 |
gcggagcattgtatcggctgagatggaccgcggtatacccatc |
47561248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 337 - 391
Target Start/End: Complemental strand, 47561182 - 47561128
Alignment:
Q |
337 |
acaaaacgactcaccctctccactactcaaacacgatgcttccttccctcatact |
391 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
47561182 |
acaaaacggctcaccctctccactactcaaacacgacgcttccttccctcatact |
47561128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1686 times since January 2019
Visitors: 3672