View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_24 (Length: 408)
Name: NF0526_high_24
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 28 - 402
Target Start/End: Original strand, 30590166 - 30590540
Alignment:
| Q |
28 |
ctgttgcaaggatttgaggagaaagacgatgccatcagtccgttgacaaaacctgggatgtttaatactgattaccatcaaaataacattaatgatagca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590166 |
ctgttgcaaggatttgaggagaaagacgatgccatcagtccgttgacaaaacctgggatgtttaatactgattaccatcaaaataacattaatgatagca |
30590265 |
T |
|
| Q |
128 |
attatgagttttatcaggaggtgagtttctttcacttgttctggagaatcttctatatatctttgccannnnnnnnnnnnnnnngaaattcacaatgtta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30590266 |
attatgagttttatcaggaggtgagtttctttcacttgttctggagaatcttctatatatctttgccattttttgttttgttttgaaattcacaatgtta |
30590365 |
T |
|
| Q |
228 |
gtattatgctgggattggagatcaaaacctcaaccttcatatcgccccactcctcaactcccccaccccagccaccaagccatccatatatcccctatat |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590366 |
gtattatgctgggattggagatcaaaacctcaaccttcttatcactccactcctcaactcccccaccccagccaccaagccatccatatatcccctatat |
30590465 |
T |
|
| Q |
328 |
atgtgtgtggtatatgcgtgacatgttaatttgtctggttcttaatttgaagcaccctaattattttcttttctc |
402 |
Q |
| |
|
|| |||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590466 |
atatgtgtgctatatgcgtgacatgctaatttgtccggttcttaatttgaagcaccctaattattttcttttctc |
30590540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 32333566 - 32333606
Alignment:
| Q |
283 |
aactcccccaccccagccaccaagccatccatatatcccct |
323 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
32333566 |
aactcccccaccccagccaccaagctatctgtatatcccct |
32333606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 309 times since January 2019
Visitors: 3649