View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_44 (Length: 268)
Name: NF0526_high_44
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_high_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 47 - 227
Target Start/End: Complemental strand, 18065789 - 18065612
Alignment:
Q |
47 |
ggttgattgaatcggagatctattcgatgnnnnnnncggaacttaataataatctacacgatcgtggtttctgagaagtgattaattttggaagcgattc |
146 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
18065789 |
ggttgattgaatcggagatctattcgatgagaaaaacggaact---taataatctacacaatcgtggtttctgagaagtgattatttttggaagcgattc |
18065693 |
T |
 |
Q |
147 |
tgcttttgatcgtttagcttgcttacgcggtaagcgttgaaacaacgaatcatccacgaaataattcgttttcatcttttc |
227 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18065692 |
tgcttttgatcgtttagcttgcttacgcggtaagcgttgaaacaacgaatcatccacgaaataattcgttttcatcttttc |
18065612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University