View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_53 (Length: 252)
Name: NF0526_high_53
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_high_53 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 7092835 - 7093090
Alignment:
| Q |
1 |
ttatcgaaaaatttgcacgggtagcagacatatagatgagataacgtaaatgtaccgcatggtccactctccaacaattatacaactcatattcattcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7092835 |
ttatcgaaaaatttgcacgggtagcagacatatagatgagataacgtaaatgtaccgcatggtccactctccaacaattatacaactcatattcattcac |
7092934 |
T |
|
| Q |
101 |
gatcacaagtat----cactatggcccagcagaaacatgttattcattcattgtcatttatttggtgtctatattttgtgaatattgtaccttgtttctt |
196 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7092935 |
gatcacaagtatatatcactatggcccagcagaaacatgttattcattcattgtcatttatttggtgtctatattttgtgaatattgtaccttgtttctt |
7093034 |
T |
|
| Q |
197 |
aaacagatgggaagtgcaatcaattatggcgttctagttgttttttaacaaacaaa |
252 |
Q |
| |
|
|||||||| |||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7093035 |
aaacagataggaaatgcaatcaattatggccttctagttgttttttaacaaacaaa |
7093090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1361 times since January 2019
Visitors: 3669