View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_54 (Length: 252)
Name: NF0526_high_54
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_high_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 48015845 - 48016073
Alignment:
Q |
1 |
cacattaaagaaattgtaagcagtaaatgttgaatgaaattacttggagtttaggactacaaatcctacaaggccagccgcctcgcgaagtgccggtctc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
48015845 |
cacattaaagaaattgtaagcagtaaatgttgaatgaaattacttggagtttaggactacaaatcctacaaggccagccgcctcgcgaagtgccagtctc |
48015944 |
T |
 |
Q |
101 |
catgcttgctcaaaatactgacgaagctgcaatttgtagttcttattctctaaacacaacttacgttccctctttgaaatcttcgtcaaaagattttgaa |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
48015945 |
catgcttgctcaaaatactgacgaagctgcaatttgtagttcttattctctaaacgcaacttatgttccctctttgaaatcttcgtcaaaagattttgaa |
48016044 |
T |
 |
Q |
201 |
atgctattccgaactcaccaatttgatga |
229 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
48016045 |
atgctattccgaactcaccaatttgatga |
48016073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1000 times since January 2019
Visitors: 3662