View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0526_high_58 (Length: 251)

Name: NF0526_high_58
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0526_high_58
NF0526_high_58
[»] chr3 (1 HSPs)
chr3 (142-242)||(40737966-40738066)
[»] chr4 (2 HSPs)
chr4 (170-236)||(6355601-6355667)
chr4 (190-242)||(23805617-23805669)
[»] chr2 (1 HSPs)
chr2 (179-240)||(26624821-26624882)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 142 - 242
Target Start/End: Complemental strand, 40738066 - 40737966
Alignment:
142 gggggtttaaatttaataaattataaaaggagattgaagatgacactgaaactctattttggtgggacctgttgattgatggtatgatcttgaagaataa 241  Q
    |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
40738066 gggggtttaaatttaataaattataaaaggagattgaagatggcaccgaaactctattttggtgggacctgttgattgatggtatgatcttgaagaataa 40737967  T
242 t 242  Q
    |    
40737966 t 40737966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 170 - 236
Target Start/End: Original strand, 6355601 - 6355667
Alignment:
170 ggagattgaagatgacactgaaactctattttggtgggacctgttgattgatggtatgatcttgaag 236  Q
    |||||| | ||||| |||| ||||| ||||||||||||||| || ||||||||||||||||||||||    
6355601 ggagataggagatggcactaaaactttattttggtgggacccgtggattgatggtatgatcttgaag 6355667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 190 - 242
Target Start/End: Original strand, 23805617 - 23805669
Alignment:
190 aaactctattttggtgggacctgttgattgatggtatgatcttgaagaataat 242  Q
    ||||| |||||||||||||  ||| ||||||||||||||| ||||||| ||||    
23805617 aaactttattttggtgggatatgtggattgatggtatgatattgaagagtaat 23805669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 179 - 240
Target Start/End: Original strand, 26624821 - 26624882
Alignment:
179 agatgacactgaaactctattttggtgggacctgttgattgatggtatgatcttgaagaata 240  Q
    ||||| |||| ||||| ||||||||||| | | || ||||||||||||||||||||||||||    
26624821 agatggcactaaaactttattttggtggcatccgtggattgatggtatgatcttgaagaata 26624882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1060 times since January 2019
Visitors: 3662