View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_62 (Length: 245)
Name: NF0526_high_62
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_high_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 55
Target Start/End: Complemental strand, 14663354 - 14663321
Alignment:
Q |
22 |
catcttcttcctcttttcccttaaccaaatcaaa |
55 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
14663354 |
catcttcttcctcttttcccttaaccaaatcaaa |
14663321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 213
Target Start/End: Complemental strand, 14663168 - 14663137
Alignment:
Q |
182 |
atcgatctcaggtatctcaattcctatcctat |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
14663168 |
atcgatctcaggtatctcaattcctatcctat |
14663137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 109
Target Start/End: Complemental strand, 14663289 - 14663253
Alignment:
Q |
73 |
gattacttgatccttccagcaagctatgaccatgttc |
109 |
Q |
|
|
|||||||||||||||||| |||||||| ||||||||| |
|
|
T |
14663289 |
gattacttgatccttccatcaagctattaccatgttc |
14663253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 55
Target Start/End: Original strand, 5079959 - 5079992
Alignment:
Q |
22 |
catcttcttcctcttttcccttaaccaaatcaaa |
55 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
5079959 |
catcttcttcctcttttcccttaaccaaatcaaa |
5079992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University