View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_66 (Length: 244)
Name: NF0526_high_66
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_high_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 48015869 - 48015646
Alignment:
Q |
1 |
tactgcttacaatttctttaatgtgtgtttgaacgggtaattgaaaattctgtaagataagaaagaaatttcaaattcaatgataagttgtgttaaatag |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48015869 |
tactgcttacaatttctttaatgtgtgtttgaacgggtaattgaaaattctgtaagataagaaagaaatttcaaattcaatgataagttgtgttaaatag |
48015770 |
T |
 |
Q |
101 |
taacaatctgtacaagacttcgatcctcacagcaagtttttgtgactagtcca--gttctctcacacacacgtcggactataattattttacggaaattt |
198 |
Q |
|
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48015769 |
taacaatctgtacaagactttgatcctcacagcaactttttgtgactagtccaactctctctcacacacacgtcggactataattattttacggaaattt |
48015670 |
T |
 |
Q |
199 |
tctatacttttgacatatgcatat |
222 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
48015669 |
tctatacttttgacatatgcatat |
48015646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1625 times since January 2019
Visitors: 3672