View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_74 (Length: 238)
Name: NF0526_high_74
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_high_74 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 43207295 - 43207152
Alignment:
| Q |
1 |
taaacaaagttcgctaaggatagaaatttattcattaatttcgcatattgtcgcgaagcacctaaagcttacatcctagataaaat-aattaaattacat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||| | |
|
|
| T |
43207295 |
taaacaaagttcgctaaggatagaaatttattcattaatttcgcatattgtcgcgaagcacctaaagcttacatcctagataaaataaactacattgctg |
43207196 |
T |
|
| Q |
100 |
tgctgagagttattgagatgttgcgaaggcctttaaggttcttg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43207195 |
agctgagagttattgagatgttgcgaaggcctttaaggttcttg |
43207152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 373 times since January 2019
Visitors: 3650