View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_high_88 (Length: 214)
Name: NF0526_high_88
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_high_88 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 1026671 - 1026775
Alignment:
| Q |
1 |
tctgattataagattcatctctcttaatctcttggtgttgtaaattgtagtggcaattgcaatcacaaacttgatctgatatataagaaaaacccatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1026671 |
tctgattataagattcatctctcttaatctcttggtgttgtaaattgtagtggcaattgcaatcacaaacttgatctgatatataagaaaaacccatttg |
1026770 |
T |
|
| Q |
101 |
aggaa |
105 |
Q |
| |
|
||||| |
|
|
| T |
1026771 |
aggaa |
1026775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 126 times since January 2019
Visitors: 3674