View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_102 (Length: 234)
Name: NF0526_low_102
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_102 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 215
Target Start/End: Original strand, 14663321 - 14663354
Alignment:
| Q |
182 |
tttgatttggttaagggaaaagaggaagaagatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14663321 |
tttgatttggttaagggaaaagaggaagaagatg |
14663354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 55
Target Start/End: Original strand, 14663139 - 14663168
Alignment:
| Q |
26 |
aggataggaattgagatacctgagatcgat |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14663139 |
aggataggaattgagatacctgagatcgat |
14663168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 164
Target Start/End: Original strand, 14663253 - 14663289
Alignment:
| Q |
128 |
gaacatggtcatagcttgctggaaggatcaagtaatc |
164 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
14663253 |
gaacatggtaatagcttgatggaaggatcaagtaatc |
14663289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 215
Target Start/End: Complemental strand, 5079992 - 5079959
Alignment:
| Q |
182 |
tttgatttggttaagggaaaagaggaagaagatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5079992 |
tttgatttggttaagggaaaagaggaagaagatg |
5079959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1195 times since January 2019
Visitors: 3665