View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_106 (Length: 231)
Name: NF0526_low_106
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_106 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 14663137 - 14663220
Alignment:
| Q |
20 |
ataggataggaattgagatacctgagatcgatagaagaagcagatgagagcaatgggggcgagtgagatgaaaacgtgcatagc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||| |
|
|
| T |
14663137 |
ataggataggaattgagatacctgagatcgatagaagaagcagatgagagcagtgggggcgagagagaggaaaacgtgcatagc |
14663220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 211
Target Start/End: Original strand, 14663321 - 14663354
Alignment:
| Q |
178 |
tttgatttggttaagggaaaagaggaagaagatg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
14663321 |
tttgatttggttaagggaaaagaggaagaagatg |
14663354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 124 - 160
Target Start/End: Original strand, 14663253 - 14663289
Alignment:
| Q |
124 |
gaacatggtcatagcttgctggaaggatcaagtaatc |
160 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
14663253 |
gaacatggtaatagcttgatggaaggatcaagtaatc |
14663289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 25 - 103
Target Start/End: Complemental strand, 2252445 - 2252367
Alignment:
| Q |
25 |
ataggaattgagatacctgagatcgatagaagaagcagatgagagcaatgggggcgagtgagatgaaaacgtgcatagc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | |||| ||| |||| |||||| |||||||| |
|
|
| T |
2252445 |
ataggaattgagatacctgagatcgatagaagaagcagatgagagcggttggggtgagagagaggaaaacatgcatagc |
2252367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 25 - 82
Target Start/End: Complemental strand, 5080141 - 5080084
Alignment:
| Q |
25 |
ataggaattgagatacctgagatcgatagaagaagcagatgagagcaatgggggcgag |
82 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5080141 |
ataggaattgagatacatgagatcgatagaagaagcagatgagagcagtgggggcgag |
5080084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 178 - 211
Target Start/End: Complemental strand, 5079992 - 5079959
Alignment:
| Q |
178 |
tttgatttggttaagggaaaagaggaagaagatg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5079992 |
tttgatttggttaagggaaaagaggaagaagatg |
5079959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 25 - 102
Target Start/End: Original strand, 208046 - 208123
Alignment:
| Q |
25 |
ataggaattgagatacctgagatcgatagaagaagcagatgagagcaatgggggcgagtgagatgaaaacgtgcatag |
102 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| | | ||| |||| |||| |||||| ||||||| |
|
|
| T |
208046 |
ataggaattgagatacctgagatcaatagaagaagcagatgagagtagttgggacgagagagaggaaaacatgcatag |
208123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University