View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_117 (Length: 212)
Name: NF0526_low_117
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_low_117 |
 |  |
|
[»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 111 - 194
Target Start/End: Complemental strand, 14663220 - 14663137
Alignment:
Q |
111 |
gctatgcacgttttcatatcactcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctatcctat |
194 |
Q |
|
|
||||||||||||||| | || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14663220 |
gctatgcacgttttcctctctctcgcccccactgctctcatctgcttcttctatcgatctcaggtatctcaattcctatcctat |
14663137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 14663354 - 14663321
Alignment:
Q |
5 |
catcttcttcctcttttcccttaaccaaatcaaa |
38 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
14663354 |
catcttcttcctcttttcccttaaccaaatcaaa |
14663321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 14663289 - 14663253
Alignment:
Q |
56 |
gattacttgatccttccagcaagctatgaccatgttc |
92 |
Q |
|
|
|||||||||||||||||| |||||||| ||||||||| |
|
|
T |
14663289 |
gattacttgatccttccatcaagctattaccatgttc |
14663253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 5080084 - 5080141
Alignment:
Q |
132 |
ctcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctat |
189 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
5080084 |
ctcgcccccactgctctcatctgcttcttctatcgatctcatgtatctcaattcctat |
5080141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 5079959 - 5079992
Alignment:
Q |
5 |
catcttcttcctcttttcccttaaccaaatcaaa |
38 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
5079959 |
catcttcttcctcttttcccttaaccaaatcaaa |
5079992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 111 - 189
Target Start/End: Original strand, 2252367 - 2252445
Alignment:
Q |
111 |
gctatgcacgttttcatatcactcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctat |
189 |
Q |
|
|
|||||||| |||||| | || ||| |||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2252367 |
gctatgcatgttttcctctctctcaccccaaccgctctcatctgcttcttctatcgatctcaggtatctcaattcctat |
2252445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 208123 - 208046
Alignment:
Q |
112 |
ctatgcacgttttcatatcactcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctat |
189 |
Q |
|
|
||||||| |||||| | || |||| ||| | | |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
208123 |
ctatgcatgttttcctctctctcgtcccaactactctcatctgcttcttctattgatctcaggtatctcaattcctat |
208046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University