View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0526_low_117 (Length: 212)

Name: NF0526_low_117
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0526_low_117
NF0526_low_117
[»] chr8 (3 HSPs)
chr8 (111-194)||(14663137-14663220)
chr8 (5-38)||(14663321-14663354)
chr8 (56-92)||(14663253-14663289)
[»] chr5 (2 HSPs)
chr5 (132-189)||(5080084-5080141)
chr5 (5-38)||(5079959-5079992)
[»] chr3 (1 HSPs)
chr3 (111-189)||(2252367-2252445)
[»] scaffold0011 (1 HSPs)
scaffold0011 (112-189)||(208046-208123)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 111 - 194
Target Start/End: Complemental strand, 14663220 - 14663137
Alignment:
111 gctatgcacgttttcatatcactcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctatcctat 194  Q
    ||||||||||||||| | || |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
14663220 gctatgcacgttttcctctctctcgcccccactgctctcatctgcttcttctatcgatctcaggtatctcaattcctatcctat 14663137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 14663354 - 14663321
Alignment:
5 catcttcttcctcttttcccttaaccaaatcaaa 38  Q
    ||||||||||||||||||||||||||||||||||    
14663354 catcttcttcctcttttcccttaaccaaatcaaa 14663321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 92
Target Start/End: Complemental strand, 14663289 - 14663253
Alignment:
56 gattacttgatccttccagcaagctatgaccatgttc 92  Q
    |||||||||||||||||| |||||||| |||||||||    
14663289 gattacttgatccttccatcaagctattaccatgttc 14663253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 5080084 - 5080141
Alignment:
132 ctcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctat 189  Q
    |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||    
5080084 ctcgcccccactgctctcatctgcttcttctatcgatctcatgtatctcaattcctat 5080141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 5079959 - 5079992
Alignment:
5 catcttcttcctcttttcccttaaccaaatcaaa 38  Q
    ||||||||||||||||||||||||||||||||||    
5079959 catcttcttcctcttttcccttaaccaaatcaaa 5079992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 111 - 189
Target Start/End: Original strand, 2252367 - 2252445
Alignment:
111 gctatgcacgttttcatatcactcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctat 189  Q
    |||||||| |||||| | || ||| |||| |  ||||||||||||||||||||||||||||||||||||||||||||||    
2252367 gctatgcatgttttcctctctctcaccccaaccgctctcatctgcttcttctatcgatctcaggtatctcaattcctat 2252445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 208123 - 208046
Alignment:
112 ctatgcacgttttcatatcactcgcccccattgctctcatctgcttcttctatcgatctcaggtatctcaattcctat 189  Q
    ||||||| |||||| | || |||| ||| | | |||||||||||||||||||| ||||||||||||||||||||||||    
208123 ctatgcatgttttcctctctctcgtcccaactactctcatctgcttcttctattgatctcaggtatctcaattcctat 208046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 317 times since January 2019
Visitors: 3649