View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_15 (Length: 527)
Name: NF0526_low_15
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 5e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 288 - 512
Target Start/End: Original strand, 15541060 - 15541289
Alignment:
Q |
288 |
attgatgttcctatttttagtacacacaaaatattgttgttcaagtgttttccgttttgtcctattttaataatttatttttgtggtattaataataatt |
387 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15541060 |
attgatgttcctatttttagtacacacaaaatattgttgttcaagtgttttccgttttgtcctattttaataatttatttttgtggtattaataataatt |
15541159 |
T |
 |
Q |
388 |
agctacctaaat-aaataattgtaagcaaaacatttgtaat----atttaatgtagtttaaataacttcagtaannnnnnngttgatgttctgggttcga |
482 |
Q |
|
|
|||||||||||| || ||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||| ||||| ||||| || |
|
|
T |
15541160 |
agctacctaaatgaattaattgtaagcaaaacatttgtaatattaatttaaagtagtttaaataacttcagtaattttgttgttggtgttcggggtttga |
15541259 |
T |
 |
Q |
483 |
attccggaccttgcatatatcatgcgttgt |
512 |
Q |
|
|
|||||||||||||||||||||||| ||||| |
|
|
T |
15541260 |
attccggaccttgcatatatcatgtgttgt |
15541289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 269 - 322
Target Start/End: Original strand, 2836928 - 2836981
Alignment:
Q |
269 |
agtagtttgatctgcataaattgatgttcctatttttagtacacacaaaatatt |
322 |
Q |
|
|
|||||||| |||||||||||||||| ||||||||||| |||||| | |||||| |
|
|
T |
2836928 |
agtagttttatctgcataaattgattttcctatttttgctacacatagaatatt |
2836981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University