View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_30 (Length: 414)
Name: NF0526_low_30
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 29 - 325
Target Start/End: Original strand, 41077750 - 41078046
Alignment:
| Q |
29 |
aaggattgccacaattacttggtgtggtggatgtgtctatgatggtagccatgggttcaagaagtgagtcataatggagattataattccattttgctgc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077750 |
aaggattgccacaattacttggtgtggtggatgtgtctatgatggtagccatgggttcaagaagtgagtcataatggagattataattccattttgctgc |
41077849 |
T |
|
| Q |
129 |
agcatcagtttagctgctctggtgacaatatctttttagtgcttagtaattagtattccttagttgtatttctggttttacttcataggttttgtatgca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077850 |
agcatcagtttagctgctctggtgacaatatctttttagtgcttagtaattagtattccttagttgtatttctggttttacttcataggttttgtatgca |
41077949 |
T |
|
| Q |
229 |
gaatcatgagatgtgtgcctatattgtattatgctatgctttaattgattctatgttttcatggatgtatactgaccccttttatgcatgtcttcta |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077950 |
gaatcatgagatgtgtgcctatattgtattatgctatgctttaattgattctatgttttcatggatgtatactgaccccttttatgcatgtcttcta |
41078046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 233 - 283
Target Start/End: Original strand, 1217178 - 1217228
Alignment:
| Q |
233 |
catgagatgtgtgcctatattgtattatgctatgctttaattgattctatg |
283 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
1217178 |
catgagatgtgtgcttgaattttattatgctatgctttaattgattctatg |
1217228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 290
Target Start/End: Complemental strand, 4132091 - 4132034
Alignment:
| Q |
233 |
catgagatgtgtgcctatattgtattatgctatgctttaattgattctatgttttcat |
290 |
Q |
| |
|
|||||||| ||||| | |||||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
4132091 |
catgagatatgtgcttgaattgtattgtgctatgctttaatcgattctatgttatcat |
4132034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1272 times since January 2019
Visitors: 3667