View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_39 (Length: 372)
Name: NF0526_low_39
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 1e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 102 - 344
Target Start/End: Original strand, 11112193 - 11112436
Alignment:
| Q |
102 |
tagtaacttctaaaagccaacaagttgagaagcaaaatcaaaataccctagtccataaaatgaaaatttcacgaaggtagtgacaaacctgatattaaat |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11112193 |
tagtaacttctaaaaaccaacaagttgagaagcaaaatcaaaataccctaatccataaaatgaaaatttcacgaaggtagtgacaaacctgatattaaat |
11112292 |
T |
|
| Q |
202 |
aaccttgtgatggnnnnnnnn---ttgttatacacaactaatagattatttagggctagctggttaaaatagtatagggagggggtcaaatatacacaac |
298 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11112293 |
aaccttg--atggaaaaaaaaaaattgttatacacaactaatagattatttagggctagctggttaaaatagtatagggagggggtgaaatatacacaac |
11112390 |
T |
|
| Q |
299 |
taatataattgtacttgtcttaggagtctatttagaccctctattt |
344 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11112391 |
taatataattgtacttgtcttaagagtctatttagaccctctattt |
11112436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 20 times since January 2019
Visitors: 3646