View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_47 (Length: 332)
Name: NF0526_low_47
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 96 - 262
Target Start/End: Complemental strand, 1008736 - 1008570
Alignment:
| Q |
96 |
gataaggtggggaaaattaagcttggcttttctaccacggatcttgaaagtggctctatcaaaagccaaaccagcttcttcttcagtttcgtacgttcca |
195 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1008736 |
gataaggtggggaaaattgagcttggcttttctaccacggatcttgaaagtggctctatcataagccaaaccagcttcttcttcagtttcgtacgttcca |
1008637 |
T |
|
| Q |
196 |
agccaaactctagctccattcttctttggatcccttatctccgcagcaaatttcccccatggccttc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1008636 |
agccaaactctagctccattcttctttggatcccttatctctgcagcaaatttcccccatggccttc |
1008570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 9e-24; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 100 - 260
Target Start/End: Complemental strand, 31415011 - 31414851
Alignment:
| Q |
100 |
aggtggggaaaattaagcttggcttttctaccacggatcttgaaagtggctctatcaaaagccaaaccagcttcttcttcagtttcgtacgttccaagcc |
199 |
Q |
| |
|
||||||||||||||||||||||| |||| || || ||||| |||| ||| | || |||||||| | ||||| || ||||| | ||||||||||||| |
|
|
| T |
31415011 |
aggtggggaaaattaagcttggcctttcggcctcgcatcttaaaagcagctttgtcgtaagccaaagctgcttcctcctcagtcacatacgttccaagcc |
31414912 |
T |
|
| Q |
200 |
aaactctagctccattcttctttggatcccttatctccgcagcaaatttcccccatggcct |
260 |
Q |
| |
|
|||||||||| |||||||| |||||||| |||||||| || || || |||||||||||||| |
|
|
| T |
31414911 |
aaactctagcaccattcttttttggatctcttatctcagctgcgaacttcccccatggcct |
31414851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 100 - 260
Target Start/End: Complemental strand, 31411050 - 31410890
Alignment:
| Q |
100 |
aggtggggaaaattaagcttggcttttctaccacggatcttgaaagtggctctatcaaaagccaaaccagcttcttcttcagtttcgtacgttccaagcc |
199 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| ||||| |||| ||| | || |||||||| | ||||| || ||||| | || || ||||||| |
|
|
| T |
31411050 |
aggtggggaaaattaagcttggcctttcggccacgcatcttaaaagcagctttgtcgtaagccaaagctgcttcctcctcagtcacataagtaccaagcc |
31410951 |
T |
|
| Q |
200 |
aaactctagctccattcttctttggatcccttatctccgcagcaaatttcccccatggcct |
260 |
Q |
| |
|
|||| ||||| |||||||| |||||||| |||||||| || || || |||||||||||||| |
|
|
| T |
31410950 |
aaaccctagcaccattcttttttggatctcttatctctgccgcgaacttcccccatggcct |
31410890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 100 - 260
Target Start/End: Complemental strand, 31407873 - 31407713
Alignment:
| Q |
100 |
aggtggggaaaattaagcttggcttttctaccacggatcttgaaagtggctctatcaaaagccaaaccagcttcttcttcagtttcgtacgttccaagcc |
199 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| |||||||||| ||| |||| |||| ||||| ||||| || ||||| | || || ||||||| |
|
|
| T |
31407873 |
aggtggggaaaattaagcttggccttttggccacgcatcttgaaagcagctttatcgtaagcaaaacctgcttcctcctcagtcacataagtaccaagcc |
31407774 |
T |
|
| Q |
200 |
aaactctagctccattcttctttggatcccttatctccgcagcaaatttcccccatggcct |
260 |
Q |
| |
|
|||| ||||| |||||||| ||||| || |||||||| || ||||| || ||||| ||||| |
|
|
| T |
31407773 |
aaaccctagcaccattcttttttgggtctcttatctctgcggcaaactttccccacggcct |
31407713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 190 - 259
Target Start/End: Original strand, 41379153 - 41379222
Alignment:
| Q |
190 |
gttccaagccaaactctagctccattcttctttggatcccttatctccgcagcaaatttcccccatggcc |
259 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||| | |||||||| |||||||||||||| |||| |
|
|
| T |
41379153 |
gttccaagccaaactctagctccgttcttcgccggatcacgaatctccgccgcaaatttcccccacggcc |
41379222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 226 - 262
Target Start/End: Original strand, 19720012 - 19720048
Alignment:
| Q |
226 |
tcccttatctccgcagcaaatttcccccatggccttc |
262 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
19720012 |
tcccttatctccgccgcgaatttcccccatggccttc |
19720048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 262
Target Start/End: Complemental strand, 18652950 - 18652910
Alignment:
| Q |
222 |
tggatcccttatctccgcagcaaatttcccccatggccttc |
262 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
18652950 |
tggatcccttatctcagctgcaaatttcccccatggccttc |
18652910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1431 times since January 2019
Visitors: 3669