View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_52 (Length: 305)
Name: NF0526_low_52
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_low_52 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 74 - 305
Target Start/End: Original strand, 19903765 - 19903996
Alignment:
Q |
74 |
actttctctaactgccacattctaaatactctcgaaggtccctttcttcccgtcaccgttcccttcgacacttccttgcgcggcgacaccgaagacttac |
173 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19903765 |
actttctctaactgccacattccaaatactctcgaaggtccctttcttcccgtcaccgttcccttcgacacttccttgcgcggcgacaccgaagacttac |
19903864 |
T |
 |
Q |
174 |
ccgacgatgatcctcgtgttcgccgtcaggtcaccggcttccagccagagcagatttcactttctctctccaccactcatcactccgtttggctctcatg |
273 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19903865 |
ccgacgatgatccccgtgttcgccgtcaggtcaccggcttccagccagagcagatttcactttctctctccaccactcatcactccgtttggctctcatg |
19903964 |
T |
 |
Q |
274 |
gattacaggtatgagcgagcataacaatatta |
305 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
19903965 |
gattacaggtatgagcgagcataacaatatta |
19903996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University