View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0526_low_54 (Length: 288)

Name: NF0526_low_54
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0526_low_54
NF0526_low_54
[»] chr3 (1 HSPs)
chr3 (60-244)||(55301066-55301250)


Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 60 - 244
Target Start/End: Original strand, 55301066 - 55301250
Alignment:
60 cgtgcgtcacaagttgggaatgagaatgtactaataaatacagagacaacagatttgaaagaggaactcagagacttttggttgggtggtcaaaagactg 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
55301066 cgtgcgtcacaagttgggaatgagaatgtactaataaatacagagacaacaggtttgaaagaggaactcagagacttttggttgggtggtcaaaagactg 55301165  T
160 cttctgaacaaacagtgtcaatggaattaccttgtgagcataagtcgatgaacacggctgaggaaggaaatatgtatgagtatct 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
55301166 cttctgaacaaacagtgtcaatggaattaccttgtgagcataagtcgatgaacacggctgtggaaggaaatatgtatgagtatct 55301250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 581 times since January 2019
Visitors: 3653