View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_54 (Length: 288)
Name: NF0526_low_54
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0526_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 60 - 244
Target Start/End: Original strand, 55301066 - 55301250
Alignment:
Q |
60 |
cgtgcgtcacaagttgggaatgagaatgtactaataaatacagagacaacagatttgaaagaggaactcagagacttttggttgggtggtcaaaagactg |
159 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55301066 |
cgtgcgtcacaagttgggaatgagaatgtactaataaatacagagacaacaggtttgaaagaggaactcagagacttttggttgggtggtcaaaagactg |
55301165 |
T |
 |
Q |
160 |
cttctgaacaaacagtgtcaatggaattaccttgtgagcataagtcgatgaacacggctgaggaaggaaatatgtatgagtatct |
244 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
55301166 |
cttctgaacaaacagtgtcaatggaattaccttgtgagcataagtcgatgaacacggctgtggaaggaaatatgtatgagtatct |
55301250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University