View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0526_low_59 (Length: 281)
Name: NF0526_low_59
Description: NF0526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0526_low_59 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 41 - 176
Target Start/End: Complemental strand, 3823326 - 3823191
Alignment:
| Q |
41 |
tgagatgaactaaacataaggtgaatcaccaattcgattgttgaaattgtatggattgaacaatctaaaatggcgaaaataccattaactcgttttcaaa |
140 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3823326 |
tgagatgaaccaaacataaggtgaatcaccaatttgattgttgaaattgtatggatcgaacaatctaaaatggcgaaaataccattaactcattttcaaa |
3823227 |
T |
|
| Q |
141 |
ttttcaaccattatcctttctcctccactcctctcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3823226 |
ttttcaaccattatcctttctcctccactcctctcc |
3823191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 133 times since January 2019
Visitors: 3647